Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
mmu-circRNA-2443 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | chr11:105221186-105241661:+ | Build | n/a |
Disease | Osteoarthritis (OA) | ICD-10 | Polyarthrosis, unspecified (M15.9) |
DBLink | Link to database | PMID | 29247798 |
Experimental Method | |||
Sample Type | Mouse Articular Chondrocytes (MACs) | Comparison | Mouse Articular Chondrocytes (MACs) were cultured in DMEM medium with and without IL-1β stimulation |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGACTTAGAGAAGAAGGAAGGAAGA ReverseTGCTGCACTGCCATCTA AAC | Statistics | Fold Change : Upregulated,3.674148 pvalue : p=0.027496 |
Citation | |||
Zhou, Z, Du, D, Chen, A, Zhu, L (2018). Circular RNA expression profile of articular chondrocytes in an IL-1β-induced mouse model of osteoarthritis. Gene, 644:20-26. |